Integratie van microfluïdische monstervoorbereiding met PCR-detectie om de effecten

mapi-research

Integratie van microfluïdische monstervoorbereiding met PCR-detectie om de effecten

Klinisch nut van Droplet Digital PCR om BCR-ABL1-transcripten van patiënten met Philadelphia-chromosoom-positieve aigu lymfoblastische leukemie te monitoren Put up-chimere antigeenreceptor 19/22 T-celcocktailtherapie

La leucémie aiguë lymphoblastique à chromosome Philadelphie (  LAL Ph + ) représente 20 à 30 % des sufferers adultes atteints de LAL, caractérisée par une translocation de   (9, 22) . Les inhibiteurs de la tyrosine kinase (ITK) ont considérablement amélioré les résultats, même s’il existe encore des problèmes, notamment des rechutes dues à des mutations résistantes aux médicaments et à une profondeur de rémission moléculaire sous-optimale. Auparavant, nous avons signalé l’innocuité et l’efficacité de la perfusion séquentielle de l’ immunothérapie des cellules T du récepteur de l’antigène chimérique CD19/22 (CAR-T) dans le traitement des néoplasmes à cellules B en rechute/réfractaires (R/R), y compris les cas avec Ph + TOUT. Compte tenu de la possibilité d’une réaction plus profonde, on s’attendait à ce que davantage de sufferers atteignent une réponse optimale de maladie résiduelle minimale (MRD). Une méthode different, la PCR numérique à gouttelettes duplex (ddPCR) à haute sensibilité a été établie, qui pourrait fournir une quantification absolue de la MRD sans avoir besoin de courbes d’étalonnage. Ici, nous avons collecté rétrospectivement 95 échantillons de moelle osseuse de 10 sufferers atteints de R/R Ph + , qui ont reçu 19/22 CAR-T-cell thérapie cocktail.

Notamment, la rémission moléculaire séquentielle pendant plus de three mois (SMR3), un indicateur significatif basé sur la ddPCR après la perfusion de CAR-T a été établie, qui a été définie comme une rémission moléculaire séquentielle pendant pas moins de three mois avec une MRD négative. Dans cette cohorte, aucune récidive n’a été observée chez six sufferers ayant obtenu une SMR3, dont quatre ont accepté une allogreffe de cellules souches hématopoïétiques (allo-HSCT) après un régime de cellules CAR-T. Malheureusement, les quatre autres sufferers qui n’ont pas atteint le SMR3 ont rechuté et n’ont pas reçu de traitement spécifique supplémentaire à l’ exception du régime CAR-T.. En résumé, la ddPCR peut être une different, surtout lorsque l’acide nucléique était insuffisant en pratique clinique. L’absence de SMR3 peut être un avertissement précoce d’une rechute potentielle après CAR-T et indiquer l’initiation d’autres thérapies, y compris l’allo-HSCT.

Kwantitatieve detectie et monitoring van  Colletotrichum siamense  in rubberbomen rencontré behulp van PCR en temps réel

Colletotrichum siamense  est l’un des brokers pathogènes les plus importants de l’hévéa en Asie. La détection et la quantification adéquates des  populations de  C. siamense dans les hévéas sont importantes pour le suivi des épidémies de la maladie. Dans cette étude, nous avons développé une méthode de PCR en temps réel basée sur l’ITS pour détecter efficacement l’   hévéa infectant C. siamense , qui a détecté de manière fiable aussi peu que 100 fg d’ADN génomique, 100 copies d’ADN cible et 20 conidies. Le protocole PCR en temps réel a reconnu tous les   isolats de C. siamense collectés dans trois provinces de Chine , tandis qu’aucune amplification n’a été observée avec l’hévéa et ses autres brokers pathogènes. Détection et quantification de  C. siamense ont été réalisées sur des feuilles de caoutchouc infectées artificiellement et naturellement.

Nous pouvions encore détecter  C. siamense  dans des mélanges de plantes dont seulement 0,0001 % des tissus étaient infectés. Une accumulation d’  ADN de  C. siamense a été observée pendant tout le processus d’an infection aux trois stades phénologiques des feuilles, suggérant que la méthode PCR en temps réel peut être utilisée pour surveiller le   développement de C. siamense dans les arbres à caoutchouc. Enfin, la méthode a permis la détection de  C. siamense  dans des feuilles d’hévéas naturellement infectées et asymptomatiques dans les champs. Par rapport aux méthodes de détection antérieures, la méthode PCR en temps réel est plus spécifique et plus wise, et sera d’une grande utilité pour les études visant à mieux comprendre l’épidémiologie de la maladie foliaire à Colletotrichum, ainsi que la prédiction du risque de maladie et la proposition de contrôle.

Integratie van microfluïdische monstervoorbereiding met PCR-detectie om de effecten van gelijktijdige scheiding van DNA-remmers en uitwisseling van DNA-oplossingen te onderzoeken

Dans cet article, nous avons appliqué un dispositif microfluidique à canal incurvé pour séparer l’ADN de l’eau contenant des inhibiteurs de PCR et les laver simultanément dans de l’eau propre pour la détection à l’aide d’un thermocycleur PCR transportable. L’ échantillonnage de l’ADN environnemental (eDNA) est devenu une approche d’enquête efficace pour détecter les organismes rares. Cependant, les molécules d’ADNe à faible focus peuvent être masquées par des inhibiteurs de PCR lors de l’amplification et de la détection, ce qui augmente le risque de fake négatifs. Par conséquent, des applied sciences pour la séparation et le lavage de l’ADN sur website sont nécessaires de toute urgence. Notre dispositif consistait en un microcanal en demi-cercle avec une entrée d’échantillon d’inhibiteur d’ADN , une entrée de tampon propre et plusieurs sorties.

En utilisant les forces d’inertie induites par le flux, des microparticules conjuguées à l’ADN de 10 m ont été concentrées sur la paroi interne du microcanal incurvé tandis que la séparation des microparticules conjuguées à l’inhibiteur de 1 m et le lavage de l’ADN ont été réalisés simultanément avec le flux de Dean. Nous avons réalisé une focalisation, une isolation et un lavage singleplex de particules de 10 μm avec une efficacité de 94,5 ± 2,0 % . Dans des expériences en duplex avec des particules de 1 m et 10 m, des particules plus grosses ont été lavées avec une efficacité de 92,1 ± 1,6 % et une pureté de 79 ± 2 %.

En fonctionnalisant en floor les microparticules avec des groupes d’affinité contre l’ADN de saumon atlantique et l’acide humique (HA), et en traitant des échantillons de différentes concentrations dans notre appareil, nous avons réalisé une purification et une détection efficaces des molécules d’ADN à l’aide du thermocycleur PCR transportable. Notre méthode a significativement diminué les cycles de quantification PCR de Cq > 38 à Cq = 30,35 ± 0,5, ce qui a confirmé l’amélioration de l’amplification PCR. Le dispositif proposé fait un pas en avant prometteur dans la préparation d’échantillons vers un dispositif intégré qui peut être utilisé pour la purification et l’échange simultanés de resolution d’ADN dans des purposes de surveillance environnementale au level de besoin.

mapi-research
mapi-research

 

Anti-GPR119 antibody

STJ11100495 100 µl
EUR 277

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349

Polyclonal Goat Anti-GPR119 Antibody

APR16300G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-GPR119 . This antibody is tested and proven to work in the following applications:

GPR119 antibody

70R-31399 100 ug
EUR 327
Description: Rabbit polyclonal GPR119 antibody

GPR119 Antibody

ABD4892 100 ug
EUR 438

GPR119 Antibody

DF4892 200ul
EUR 304
Description: GPR119 Antibody detects endogenous levels of total GPR119.

GPR119 Antibody

1-CSB-PA007283
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GPR119. Recognizes GPR119 from Human. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/10000

Gpr119/ Rat Gpr119 ELISA Kit

ELI-08203r 96 Tests
EUR 886

GPR119 Polyclonal Antibody

ES4819-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GPR119 from Human. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

GPR119 Polyclonal Antibody

ES4819-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GPR119 from Human. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

GPR119 Polyclonal Antibody

ABP53820-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of GPR119 from Human. This GPR119 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240

GPR119 Polyclonal Antibody

ABP53820-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of GPR119 from Human. This GPR119 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240

GPR119 Polyclonal Antibody

ABP53820-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of GPR119 from Human. This GPR119 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240

GPR119 Polyclonal Antibody

40973-100ul 100ul
EUR 252

GPR119 Polyclonal Antibody

40973-50ul 50ul
EUR 187

GPR119 siRNA

20-abx902267
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPR119 siRNA

20-abx918416
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPR119 siRNA

20-abx918417
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPR119 Polyclonal Conjugated Antibody

C40973 100ul
EUR 397

GPR119 Blocking Peptide

20-abx162463
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

GPR119 Rabbit pAb

A18544-100ul 100 ul
EUR 308

GPR119 Rabbit pAb

A18544-200ul 200 ul
EUR 459

GPR119 Rabbit pAb

A18544-20ul 20 ul
EUR 183

GPR119 Rabbit pAb

A18544-50ul 50 ul
EUR 223

GPR119 Blocking Peptide

DF4892-BP 1mg
EUR 195

GPR119 cloning plasmid

CSB-CL840575HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1008
  • Sequence: atggaatcatctttctcatttggagtgatccttgctgtcctggcctccctcatcattgctactaacacactagtggctgtggctgtgctgctgttgatccacaagaatgatggtgtcagtctctgcttcaccttgaatctggctgtggctgacaccttgattggtgtggccatct
  • Show more
Description: A cloning plasmid for the GPR119 gene.

Polyclonal GPR119 Antibody (aa186-235)

APR16477G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR119 (aa186-235). This antibody is tested and proven to work in the following applications:

Polyclonal GPR119 Antibody (Cytoplasmic Domain)

APR16478G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR119 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:

Polyclonal GPR119 Antibody (Cytoplasmic Domain)

APR16479G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR119 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

Rat GPR119 shRNA Plasmid

20-abx989158
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GPR119 shRNA Plasmid

20-abx965265
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Gpr119 ELISA KIT

ELI-09750m 96 Tests
EUR 865

Human GPR119 ELISA KIT

ELI-48829h 96 Tests
EUR 824

Mouse GPR119 shRNA Plasmid

20-abx982252
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GPR119 Recombinant Protein (Human)

RP039541 100 ug Ask for price

GPR119 Recombinant Protein (Rat)

RP203282 100 ug Ask for price

GPR119 Recombinant Protein (Mouse)

RP139418 100 ug Ask for price

G-Protein Coupled Receptor 119 (GPR119) Antibody

20-abx121407
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

G Protein-Coupled Receptor 119 (GPR119) Antibody

20-abx324143
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

G-Protein Coupled Receptor 119 (GPR119) Antibody

abx215630-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

G-Protein Coupled Receptor 119 (GPR119) Antibody

abx432763-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Gpr119 ORF Vector (Rat) (pORF)

ORF067762 1.0 ug DNA
EUR 506

Gpr119 ORF Vector (Mouse) (pORF)

ORF046474 1.0 ug DNA
EUR 506

GPR119 ORF Vector (Human) (pORF)

ORF013181 1.0 ug DNA
EUR 354

GPR119 sgRNA CRISPR Lentivector set (Human)

K0895801 3 x 1.0 ug
EUR 339

Gpr119 sgRNA CRISPR Lentivector set (Mouse)

K3605701 3 x 1.0 ug
EUR 339

Gpr119 sgRNA CRISPR Lentivector set (Rat)

K7204201 3 x 1.0 ug
EUR 339

GPR119 sgRNA CRISPR Lentivector (Human) (Target 1)

K0895802 1.0 ug DNA
EUR 154

GPR119 sgRNA CRISPR Lentivector (Human) (Target 2)

K0895803 1.0 ug DNA
EUR 154

GPR119 sgRNA CRISPR Lentivector (Human) (Target 3)

K0895804 1.0 ug DNA
EUR 154

Gpr119 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3605702 1.0 ug DNA
EUR 154

Gpr119 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3605703 1.0 ug DNA
EUR 154

Gpr119 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3605704 1.0 ug DNA
EUR 154

Gpr119 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7204202 1.0 ug DNA
EUR 154

Gpr119 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7204203 1.0 ug DNA
EUR 154

Gpr119 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7204204 1.0 ug DNA
EUR 154

GPR119 Protein Vector (Human) (pPB-C-His)

PV052721 500 ng
EUR 481

GPR119 Protein Vector (Human) (pPB-N-His)

PV052722 500 ng
EUR 481

GPR119 Protein Vector (Human) (pPM-C-HA)

PV052723 500 ng
EUR 481

GPR119 Protein Vector (Human) (pPM-C-His)

PV052724 500 ng
EUR 481

GPR119 Protein Vector (Mouse) (pPB-C-His)

PV185894 500 ng
EUR 603

GPR119 Protein Vector (Mouse) (pPB-N-His)

PV185895 500 ng
EUR 603

GPR119 Protein Vector (Mouse) (pPM-C-HA)

PV185896 500 ng
EUR 603

GPR119 Protein Vector (Mouse) (pPM-C-His)

PV185897 500 ng
EUR 603

GPR119 Protein Vector (Rat) (pPB-C-His)

PV271046 500 ng
EUR 603

GPR119 Protein Vector (Rat) (pPB-N-His)

PV271047 500 ng
EUR 603

GPR119 Protein Vector (Rat) (pPM-C-HA)

PV271048 500 ng
EUR 603

GPR119 Protein Vector (Rat) (pPM-C-His)

PV271049 500 ng
EUR 603

Gpr119 3'UTR Luciferase Stable Cell Line

TU205325 1.0 ml Ask for price

Gpr119 3'UTR GFP Stable Cell Line

TU158968 1.0 ml Ask for price

GPR119 3'UTR Luciferase Stable Cell Line

TU009210 1.0 ml
EUR 2333

Gpr119 3'UTR Luciferase Stable Cell Line

TU108968 1.0 ml Ask for price

GPR119 3'UTR GFP Stable Cell Line

TU059210 1.0 ml
EUR 2333

Gpr119 3'UTR GFP Stable Cell Line

TU255325 1.0 ml Ask for price

GPR119 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV629167 1.0 ug DNA
EUR 682

GPR119 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV629171 1.0 ug DNA
EUR 682

GPR119 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV629172 1.0 ug DNA
EUR 682

GPR119 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0895805 3 x 1.0 ug
EUR 376

Gpr119 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3605705 3 x 1.0 ug
EUR 376

Gpr119 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7204205 3 x 1.0 ug
EUR 376

GPR119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0895806 1.0 ug DNA
EUR 167

GPR119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0895807 1.0 ug DNA
EUR 167

GPR119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0895808 1.0 ug DNA
EUR 167

Gpr119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3605706 1.0 ug DNA
EUR 167

Gpr119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3605707 1.0 ug DNA
EUR 167

Gpr119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3605708 1.0 ug DNA
EUR 167

GPR119 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV629168 1.0 ug DNA
EUR 682

GPR119 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV629169 1.0 ug DNA
EUR 740

GPR119 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV629170 1.0 ug DNA
EUR 740

Gpr119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7204206 1.0 ug DNA
EUR 167

Gpr119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7204207 1.0 ug DNA
EUR 167

Gpr119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K7204208 1.0 ug DNA
EUR 167

Anti-Anti-SEPT2 Antibody antibody

STJ28365 100 µl
EUR 277

Anti-Anti-SEPT7 Antibody antibody

STJ28963 100 µl
EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-SEPT6 antibody antibody

STJ11100949 100 µl
EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined.

Anti-Anti-SEPT2 Antibody antibody

STJ25475 100 µl
EUR 277

Anti-Anti-SEPT5 Antibody antibody

STJ25477 100 µl
EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-SEPT8 Antibody antibody

STJ25479 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT9 Antibody antibody

STJ111369 100 µl
EUR 277
Description: This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.

Anti-Anti-SEPT11 Antibody antibody

STJ111530 100 µl
EUR 277

Anti-Anti-SEPT4 Antibody antibody

STJ112276 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer.

Anti-Anti-MARCH9 Antibody antibody

STJ112609 100 µl
EUR 277

Anti-Anti-SEPT11 Antibody antibody

STJ113941 100 µl
EUR 277

Anti-Anti-SEPT11 Antibody antibody

STJ114081 100 µl
EUR 277

Anti-Anti-SEPT5 Antibody antibody

STJ114819 100 µl
EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-MARCH8 Antibody antibody

STJ114828 100 µl
EUR 277

Anti-Anti-MARCH6 Antibody antibody

STJ118549 100 µl
EUR 277

Anti-Anti-MARCH6 Antibody antibody

STJ118550 100 µl
EUR 277

Anti-Anti-MARCH7 Antibody antibody

STJ118752 100 µl
EUR 277

Anti-Anti-SEPT3 Antibody antibody

STJ118990 100 µl
EUR 277

Anti-Anti-SEPT1 antibody antibody

STJ119580 100 µl
EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis and the maintenance of cellular morphology. This gene encodes a protein that can form homo- and heterooligomeric filaments, and may contribute to the formation of neurofibrillary tangles in Alzheimer's disease. Alternatively spliced transcript variants have been found but the full-length nature of these variants has not been determined. [provided by RefSeq, Dec 2012]

Anti-Anti-SEPT7 Antibody antibody

STJ116214 100 µl
EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-SEPT8 Antibody antibody

STJ117206 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT12 Antibody antibody

STJ117759 100 µl
EUR 277
Description: This gene encodes a guanine-nucleotide binding protein and member of the septin family of cytoskeletal GTPases. Septins play important roles in cytokinesis, exocytosis, embryonic development, and membrane dynamics. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-DDB1 Antibody

A00333 100uL
EUR 455
Description: Rabbit Polyclonal DDB1 Antibody. Validated in IP and tested in Human, Mouse.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-10x96wellstestplate 10x96-wells test plate
EUR 5647.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-1x48wellstestplate 1x48-wells test plate
EUR 552.76
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-1x96wellstestplate 1x96-wells test plate
EUR 746.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-5x96wellstestplate 5x96-wells test plate
EUR 3060.6
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

4-AEA465Hu
  • EUR 5698.00
  • EUR 3011.00
  • EUR 747.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Anti-Sperm Antibody elisa. Alternative names of the recognized antigen: Anti-Spermatozoa Antibodies
  • Sperm Antibodies
  • Antisperm Antibodies
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Human Anti-AsAb (Anti-Anti-Sperm Antibody Antibody)

ELK8071 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antigen. Standards or samples are then added to the appropriate microtiter plate wells with a Horseradish Peroxidase (HRP)-conjugated secondary antibody. After TMB substrate soluti
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Anti-Anti-Sperm Antibody Antibody from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Anti-HAMA Antibody

E61I006 1mg
EUR 349

anti- ASH2L antibody

FNab00637 100µg
EUR 505.25
  • Immunogen: ash2(absent, small, or homeotic)-like(Drosophila)
  • Uniprot ID: Q9UBL3
  • Gene ID: 9070
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against ASH2L

anti- ASIC2 antibody

FNab00638 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:1000
  • Immunogen: amiloride-sensitive cation channel 1, neuronal
  • Uniprot ID: Q16515
  • Gene ID: 40
  • Research Area: Neuroscience
Description: Antibody raised against ASIC2

anti- ASIC4 antibody

FNab00639 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:1000
  • Immunogen: amiloride-sensitive cation channel 4, pituitary
  • Uniprot ID: Q96FT7
  • Gene ID: 55515
  • Research Area: Neuroscience
Description: Antibody raised against ASIC4

anti- ASK1 antibody

FNab00640 100µg
EUR 505.25
  • Recommended dilution: WB: 1:100-1:1000
  • Immunogen: mitogen-activated protein kinase kinase kinase 5
  • Uniprot ID: Q99683
  • Gene ID: 4217
  • Research Area: Immunology, Cardiovascular, Metabolism
Description: Antibody raised against ASK1

anti- ASL antibody

FNab00641 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:1000
  • IHC: 1:100-1:500
  • Immunogen: argininosuccinate lyase
  • Uniprot ID: P04424
  • Gene ID: 435
  • Research Area: Metabolism
Description: Antibody raised against ASL

anti- ASMTL antibody

FNab00642 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IP: 1:50 - 1:200
  • Immunogen: acetylserotonin O-methyltransferase-like
  • Uniprot ID: O95671
  • Gene ID: 8623
  • Research Area: Metabolism
Description: Antibody raised against ASMTL

anti- ASNA1 antibody

FNab00643 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: arsA arsenite transporter, ATP-binding, homolog 1 (bacterial)
  • Uniprot ID: O43681
  • Gene ID: 439
  • Research Area: Metabolism
Description: Antibody raised against ASNA1

anti- ASNS antibody

FNab00644 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:500-1:1000
  • Immunogen: asparagine synthetase
  • Uniprot ID: P08243
  • Gene ID: 440
  • Research Area: Metabolism
Description: Antibody raised against ASNS

anti- ASPA antibody

FNab00645 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:50-1:500
  • Immunogen: aspartoacylase(Canavan disease)
  • Uniprot ID: P45381
  • Gene ID: 443
  • Research Area: Metabolism
Description: Antibody raised against ASPA

anti- ASPH antibody

FNab00646 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:50-1:500
  • Immunogen: aspartate beta-hydroxylase
  • Uniprot ID: Q12797
  • Gene ID: 444
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against ASPH

anti- ASPRV1 antibody

FNab00647 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: aspartic peptidase, retroviral-like 1
  • Uniprot ID: Q53RT3
  • Gene ID: 151516
  • Research Area: Metabolism
Description: Antibody raised against ASPRV1

anti- ASRGL1 antibody

FNab00648 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:500-1:1000
  • IHC: 1:20-1:200
  • IF: 1:50-1:500
  • Immunogen: asparaginase like 1
  • Uniprot ID: Q7L266
  • Gene ID: 80150
  • Research Area: Metabolism
Description: Antibody raised against ASRGL1

anti- ASS1 antibody

FNab00649 100µg
EUR 505.25
  • Recommended dilution: WB: 1:1000-1:6000
  • IP: 1:500-1:3000
  • IHC: 1:50-1:500
  • IF: 1:50-1:500
  • Immunogen: argininosuccinate synthetase 1
  • Uniprot ID: P00966
  • Gene ID: 445
  • Research Area: Metabolism
Description: Antibody raised against ASS1

anti- ASS1 antibody

FNab00650 100µg
EUR 505.25
  • Recommended dilution: WB: 1:1000-1:4000
  • IHC: 1:100-1:500
  • IF: 1:20-1:100
  • Immunogen: argininosuccinate synthetase 1
  • Uniprot ID: P00966
  • Gene ID: 445
  • Research Area: Metabolism
Description: Antibody raised against ASS1

anti- ASTL antibody

FNab00651 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: astacin-like metallo-endopeptidase(M12 family)
  • Uniprot ID: Q6HA08
  • Gene ID: 431705
  • Research Area: Stem Cells, Metabolism
Description: Antibody raised against ASTL

anti- ASTN2 antibody

FNab00652 100µg
EUR 505.25
  • Immunogen: astrotactin 2
  • Uniprot ID: O75129
  • Gene ID: 23245
  • Research Area: Metabolism
Description: Antibody raised against ASTN2

anti- ASZ1 antibody

FNab00653 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: ankyrin repeat, SAM and basic leucine zipper domain containing 1
  • Uniprot ID: Q8WWH4
  • Gene ID: 136991
  • Research Area: Cardiovascular, Signal Transduction
Description: Antibody raised against ASZ1

anti- ATAD1 antibody

FNab00654 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:1000
  • IP: 1:200-1:1000
  • Immunogen: ATPase family, AAA domain containing 1
  • Uniprot ID: Q8NBU5
  • Gene ID: 84896
  • Research Area: Metabolism
Description: Antibody raised against ATAD1

anti- ATAD2 antibody

FNab00655 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: ATPase family, AAA domain containing 2
  • Uniprot ID: Q6PL18
  • Gene ID: 29028
  • Research Area: Metabolism
Description: Antibody raised against ATAD2

anti- ATAD5 antibody

FNab00656 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: ATPase family, AAA domain containing 5
  • Uniprot ID: Q96QE3
  • Gene ID: 79915
  • Research Area: Metabolism
Description: Antibody raised against ATAD5

anti- ATE1 antibody

FNab00658 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: arginyltransferase 1
  • Uniprot ID: O95260
  • Gene ID: 11101
  • Research Area: Metabolism
Description: Antibody raised against ATE1

anti- ATF1 antibody

FNab00659 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: activating transcription factor 1
  • Uniprot ID: P18846
  • Gene ID: 466
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against ATF1

anti- ATF2 antibody

FNab00660 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: activating transcription factor 2
  • Uniprot ID: P15336
  • Gene ID: 1386
  • Research Area: Epigenetics, Signal Transduction, Metabolism, Cardiovascular, Immunology
Description: Antibody raised against ATF2

anti- ATF4 antibody

FNab00662 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IP: 1:200-1:1000
  • IHC: 1:50-1:500
  • IF: 1:50-1:500
  • Immunogen: activating transcription factor 4(tax-responsive enhancer element B67)
  • Uniprot ID: P18848
  • Gene ID: 468
  • Research Area: Neuroscience, Epigenetics, Meta
  • Show more
Description: Antibody raised against ATF4

anti- ATF4 antibody

FNab00663 100µg
EUR 548.75
  • Recommended dilution: WB: 1:1000-1:2000
  • IHC: 1:50-1:300
  • IF: 1:20-1:100
  • Immunogen: activating transcription factor 4(tax-responsive enhancer element B67)
  • Uniprot ID: P18848
  • Gene ID: 468
  • Research Area: Neuroscience, Epigenetics, Metabolism, Developme
  • Show more
Description: Antibody raised against ATF4

anti- ATF6 antibody

FNab00664 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:500-1:2000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: activating transcription factor 6
  • Uniprot ID: P18850
  • Gene ID: 22926
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against ATF6

anti- ATF6B antibody

FNab00665 100µg
EUR 505.25
  • Recommended dilution: WB: 1:1000-1:4000
  • IP:1:500-1:2000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: activating transcription factor 6 beta
  • Uniprot ID: Q99941
  • Gene ID: 1388
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against ATF6B

anti- ATG12 antibody

FNab00666 100µg
EUR 548.75
  • Immunogen: ATG12 autophagy related 12 homolog(S. cerevisiae)
  • Uniprot ID: O94817
  • Gene ID: 9140
  • Research Area: Epigenetics, Immunology, Cardiovascular, Metabolism
Description: Antibody raised against ATG12

anti- ATG12 antibody

FNab00667 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:50-1:200
  • IF: 1:10-1:100
  • Immunogen: ATG12 autophagy related 12 homolog(S. cerevisiae)
  • Uniprot ID: O94817
  • Gene ID: 9140
  • Research Area: Epigenetics, Immunology, Cardiovascular, Metabolism
Description: Antibody raised against ATG12

anti- ATG13 antibody

FNab00668 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: KIAA0652
  • Uniprot ID: O75143
  • Gene ID: 9776
  • Research Area: Epigenetics, Immunology, Cardiovascular, Metabolism
Description: Antibody raised against ATG13

anti- ATG16L1 antibody

FNab00669 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: ATG16 autophagy related 16-like 1
  • Uniprot ID: Q676U5
  • Gene ID: 55054
  • Research Area: Cardiovascular
Description: Antibody raised against ATG16L1

anti- ATG16L2 antibody

FNab00670 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:500-1:1000
  • IF: 1:50-1:500
  • Immunogen: ATG16 autophagy related 16-like 2(S. cerevisiae)
  • Uniprot ID: Q8NAA4
  • Gene ID: 89849
  • Research Area: Cardiovascular
Description: Antibody raised against ATG16L2

anti- ATG2A antibody

FNab00671 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:1000
  • IHC: 1:20-1:200
  • Immunogen: ATG2 autophagy related 2 homolog A
  • Uniprot ID: Q2TAZ0
  • Gene ID: 23130
  • Research Area: Cardiovascular
Description: Antibody raised against ATG2A

anti- ATG2B antibody

FNab00672 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:50-1:500
  • IF: 1:10-1:100
  • Immunogen: ATG2 autophagy related 2 homolog B(S. cerevisiae)
  • Uniprot ID: Q96BY7
  • Research Area: Cardiovascular
Description: Antibody raised against ATG2B

anti- ATG3 antibody

FNab00673 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: ATG3 autophagy related 3 homolog (S. cerevisiae)
  • Uniprot ID: Q9NT62
  • Gene ID: 64422
  • Research Area: Epigenetics, Cardiovascular, Metabolism
Description: Antibody raised against ATG3

anti- ATG4B antibody

FNab00674 100µg
EUR 505.25
  • Immunogen: ATG4 autophagy related 4 homolog B(S. cerevisiae)
  • Uniprot ID: Q9Y4P1
  • Gene ID: 23192
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against ATG4B

anti- ATG4C antibody

FNab00675 100µg
EUR 505.25
  • Immunogen: ATG4 autophagy related 4 homolog C(S. cerevisiae)
  • Uniprot ID: Q96DT6
  • Gene ID: 84938
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against ATG4C

anti- ATG4D antibody

FNab00676 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: ATG4 autophagy related 4 homolog D(S. cerevisiae)
  • Uniprot ID: Q86TL0
  • Gene ID: 84971
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against ATG4D

anti- ATG5 antibody

FNab00677 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:100
  • Immunogen: ATG5 autophagy related 5 homolog
  • Uniprot ID: Q9H1Y0
  • Gene ID: 9474
  • Research Area: Immunology, Cardiovascular, Metabolism
Description: Antibody raised against ATG5

anti- ATG5 antibody

FNab00678 100µg
EUR 548.75
  • Recommended dilution: WB: 1:1000-1:3000
  • Immunogen: ATG5 autophagy related 5 homolog(S. cerevisiae)
  • Uniprot ID: Q9H1Y0
  • Gene ID: 9474
  • Research Area: Immunology, Cardiovascular, Metabolism
Description: Antibody raised against ATG5

anti- ATG7 antibody

FNab00679 100µg
EUR 548.75
  • Immunogen: ATG7 autophagy related 7 homolog(S. cerevisiae)
  • Uniprot ID: O95352
  • Gene ID: 10533
  • Research Area: Immunology, Cardiovascular, Metabolism
Description: Antibody raised against ATG7

anti- ATGL antibody

FNab00680 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: patatin-like phospholipase domain containing 2
  • Uniprot ID: Q96AD5
  • Gene ID: 57104
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against ATGL

anti- ATIC antibody

FNab00681 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:1000
  • IF: 1:10-1:100
  • Immunogen: 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase
  • Uniprot ID: P31939
  • Gene ID: 471
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against ATIC

anti- ATL2 antibody

FNab00683 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: atlastin GTPase 2
  • Uniprot ID: Q8NHH9
  • Gene ID: 64225
  • Research Area: Metabolism
Description: Antibody raised against ATL2

anti- ATL3 antibody

FNab00684 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:3000
  • IF: 1:10-1:100
  • Immunogen: atlastin GTPase 3
  • Uniprot ID: Q6DD88
  • Gene ID: 25923
  • Research Area: Metabolism
Description: Antibody raised against ATL3

anti- ATN1 antibody

FNab00685 100µg
EUR 505.25
  • Immunogen: atrophin 1
  • Uniprot ID: P54259
  • Gene ID: 1822
  • Research Area: Neuroscience
Description: Antibody raised against ATN1

anti- ATOH1 antibody

FNab00686 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: atonal homolog 1
  • Uniprot ID: Q92858
  • Gene ID: 474
  • Research Area: Neuroscience
Description: Antibody raised against ATOH1

anti- ATP11B antibody

FNab00688 100µg
EUR 505.25
  • Recommended dilution: IHC: 1:20 - 1:200
  • Immunogen: ATPase, class VI, type 11B
  • Uniprot ID: Q9Y2G3
  • Gene ID: 23200
  • Research Area: Metabolism
Description: Antibody raised against ATP11B

anti- ATP12A antibody

FNab00689 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: ATPase, H+/K+ transporting, nongastric, alpha polypeptide
  • Uniprot ID: P54707
  • Gene ID: 479
  • Research Area: Metabolism
Description: Antibody raised against ATP12A

anti- ATP13A1 antibody

FNab00690 100µg
EUR 505.25
  • Recommended dilution: WB: 1:1000-1:4000
  • IF: 1:20-1:200
  • Immunogen: ATPase type 13A1
  • Uniprot ID: Q9HD20
  • Gene ID: 57130
  • Research Area: Metabolism
Description: Antibody raised against ATP13A1

anti- ATP1A1 antibody

FNab00691 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:500
  • Immunogen: ATPase, Na+/K+ transporting, alpha 1 polypeptide
  • Uniprot ID: P05023
  • Gene ID: 476
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against ATP1A1

anti- ATP1A2 antibody

FNab00693 100µg
EUR 505.25
  • Immunogen: ATPase, Na+/K+ transporting, alpha 2(+) polypeptide
  • Uniprot ID: P50993
  • Gene ID: 477
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against ATP1A2

anti- ATP1A3 antibody

FNab00695 100µg
EUR 548.75
  • Immunogen: ATPase, Na+/K+ transporting, alpha 3 polypeptide
  • Uniprot ID: P13637
  • Gene ID: 478
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against ATP1A3

anti- ATP1B1 antibody

FNab00696 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: ATPase, Na+/K+ transporting, beta 1 polypeptide
  • Uniprot ID: P05026
  • Gene ID: 481
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against ATP1B1

anti- ATP1B2 antibody

FNab00697 100µg
EUR 548.75
  • Immunogen: ATPase, Na+/K+ transporting, beta 2 polypeptide
  • Uniprot ID: P14415
  • Gene ID: 482
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against ATP1B2

anti- ATP2A1 antibody

FNab00699 100µg
EUR 548.75
  • Immunogen: ATPase, Ca++ transporting, cardiac muscle, fast twitch 1
  • Uniprot ID: O14983
  • Gene ID: 487
  • Research Area: Metabolism
Description: Antibody raised against ATP2A1

anti- ATP2C1 antibody

FNab00700 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: ATPase, Ca++ transporting, type 2C, member 1
  • Uniprot ID: P98194
  • Gene ID: 27032
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against ATP2C1

anti- ATP4B antibody

FNab00701 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: ATPase, H+/K+ exchanging, beta polypeptide
  • Uniprot ID: P51164
  • Gene ID: 496
  • Research Area: Metabolism
Description: Antibody raised against ATP4B

anti- ATP5A1 antibody

FNab00702 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:100
  • IP: 1:50 - 1:200
  • Immunogen: ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle
  • Uniprot ID: P25705
  • Gene ID: 498
  • Research Area: Metabol
  • Show more
Description: Antibody raised against ATP5A1

anti- ATP5A1 antibody

FNab00703 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:500-1:1000
  • IHC: 1:20-1:200
  • IF: 1:20-1:200
  • Immunogen: ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle
  • Uniprot ID: P25705
  • Gene ID: 498
  • Research Area: Metabolism
Description: Antibody raised against ATP5A1

anti- ATP5C1 antibody

FNab00704 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1
  • Uniprot ID: P36542
  • Gene ID: 509
  • Research Area: Metabolism
Description: Antibody raised against ATP5C1

anti- ATP5C1 antibody

FNab00705 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:100-1:500
  • Immunogen: ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1
  • Uniprot ID: P36542
  • Gene ID: 509
  • Research Area: Metabolism
Description: Antibody raised against ATP5C1

anti- ATP5D antibody

FNab00706 100µg
EUR 505.25
  • Immunogen: ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit
  • Uniprot ID: P30049
  • Gene ID: 513
  • Research Area: Metabolism
Description: Antibody raised against ATP5D

anti- ATP5F1 antibody

FNab00707 100µg
EUR 505.25
  • Immunogen: ATP synthase, H+ transporting, mitochondrial F0 complex, subunit B1
  • Uniprot ID: P24539
  • Gene ID: 515
  • Research Area: Metabolism
Description: Antibody raised against ATP5F1

anti- ATP5H antibody

FNab00709 100µg
EUR 548.75
  • Immunogen: ATP synthase, H+ transporting, mitochondrial F0 complex, subunit d
  • Uniprot ID: O75947
  • Gene ID: 10476
  • Research Area: Metabolism
Description: Antibody raised against ATP5H

anti- ATP5I antibody

FNab00710 100µg
EUR 505.25
  • Immunogen: ATP synthase, H+ transporting, mitochondrial F0 complex, subunit E
  • Uniprot ID: P56385
  • Gene ID: 521
  • Research Area: Metabolism
Description: Antibody raised against ATP5I

anti- ATP5J antibody

FNab00711 100µg
EUR 548.75
  • Immunogen: ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F6
  • Uniprot ID: P18859
  • Gene ID: 522
  • Research Area: Metabolism
Description: Antibody raised against ATP5J

anti- ATP5L antibody

FNab00712 100µg
EUR 548.75
  • Immunogen: ATP synthase, H+ transporting, mitochondrial F0 complex, subunit G
  • Uniprot ID: O75964
  • Gene ID: 10632
  • Research Area: Metabolism
Description: Antibody raised against ATP5L

anti- ATP6AP1 antibody

FNab00713 100µg
EUR 505.25
  • Immunogen: ATPase, H+ transporting, lysosomal accessory protein 1
  • Uniprot ID: Q15904
  • Gene ID: 537
  • Research Area: Metabolism
Description: Antibody raised against ATP6AP1

anti- ATP6V0D1 antibody

FNab00714 100µg
EUR 505.25
  • Immunogen: ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1
  • Uniprot ID: P61421
  • Gene ID: 9114
  • Research Area: Metabolism
Description: Antibody raised against ATP6V0D1

SARS-CoV-2-serologie verhoogt diagnostische nauwkeurigheid bij CT-vermoede, PCR-negatieve COVID-19-patiënten tijdens pandemie

 

Contexte :  En l’absence de détection par PCR de l’ ARN du SRAS-CoV-2 , un diagnostic précis de COVID-19 est difficile. La tomodensitométrie (TDM) à faible dose détecte les infiltrats pulmonaires avec une sensibilité élevée, mais les résultats peuvent être non spécifiques. Cette étude évalue la valeur diagnostique de la sérologie SARS-CoV-2 pour les sufferers présentant des caractéristiques CT distinctes mais une PCR négative.

Méthodes : Un  immunodosage chimioluminescent IgM/IgG a été réalisé chez 107 sufferers atteints de COVID-19 confirmé (groupe A : PCR+ ; CT ±) et 46 sufferers suspectés (groupe B : PCR- répétitives ; CT+) de COVID-19, admis dans un hôpital universitaire allemand. lors de la première obscure de la pandémie. Une classification CT standardisée et interne des signes radiologiques d’une pneumonie virale a été utilisée pour évaluer la probabilité de COVID-19 .

Résultats : Les  taux de séroconversion (SR) déterminés aux jours 5, 10, 15, 20 et 25 après l’apparition des symptômes (SO) étaient de 8 %, 25 %, 65 %, 76 % et 91 % pour le groupe A et 0 %, 10 % , 19 %, 37 % et 46 % pour le groupe B, respectivement ; (p < 0,01). Par rapport aux sufferers hospitalisés avec une évolution non compliquée (sufferers non-USI), la séroconversion avait tendance à se produire à une fréquence plus faible et retardée chez les sufferers dans les unités de soins intensifs. Le SR des sufferers avec des résultats CT classés comme haute certitude pour COVID-19 était de 8 %, 22 %, 68 %, 79 % et 93 % dans le groupe A, contre 0 %, 15 %, 28 %, 50 % et 50 % dans groupe B (p < 0,01). La sérologie SARS-CoV-2 a établi un diagnostic définitif chez 12/46 sufferers du groupe B. Chez 88 % (8/9) des sufferers avec une sérologie négative > 14 jours après l’ apparition des symptômes (groupe B), la réévaluation de consensus clinico-radiologique a révélé des diagnostics probables autres que COVID-19 . La sensibilité de la sérologie SARS-CoV-2 était supérieure à la PCR > 17 jours après l’apparition des symptômes.

Conclusions :  Environ un tiers des sufferers présentant des résultats distincts de la tomodensitométrie COVID-19 sont testés négatifs pour l’ARN du SRAS-CoV-2 par PCR, ce qui rend difficile un diagnostic right. La mise en œuvre des checks sérologiques SARS-CoV-2 aux côtés des algorithmes de diagnostic actuels basés sur la CT/PCR améliore la discrimination entre les infiltrats pulmonaires liés au COVID-19 et non liés chez les sufferers négatifs à la PCR. Cependant, la sensibilité de la sérologie SARS-CoV-2 dépend fortement du second du check et devient supérieure à la PCR après la 2 e  semaine suivant l’apparition des symptômes.

 

Anti-GPR110 antibody

STJ93320 200 µl
EUR 197
Description: Rabbit polyclonal to GPR110.

anti-GPCR GPR110

YF-PA22867 50 ul
EUR 363
Description: Mouse polyclonal to GPCR GPR110

anti-GPCR GPR110

YF-PA22868 50 ug
EUR 363
Description: Mouse polyclonal to GPCR GPR110

GPR110 antibody

70R-31396 100 ug
EUR 327
Description: Rabbit polyclonal GPR110 antibody

GPR110 Antibody

44961-100ul 100ul
EUR 252

GPR110 Antibody

44961-50ul 50ul
EUR 187

GPR110 Antibody

1-CSB-PA002753
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GPR110. Recognizes GPR110 from Human. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/40000

GPR110 Antibody

DF2796 200ul
EUR 304
Description: GPR110 antibody detects endogenous levels of total GPR110.

GPR110 Antibody

DF4891 200ul
EUR 304
Description: GPR110 Antibody detects endogenous levels of total GPR110.

GPR110 antibody

70R-51217 100 ul
EUR 244
Description: Purified Polyclonal GPR110 antibody

GPR110 Antibody

ABD2796 100 ug
EUR 438

GPR110 Antibody

ABD4891 100 ug
EUR 438

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349

Polyclonal GPR110 Antibody

APR12205G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR110 . This antibody is tested and proven to work in the following applications:

GPR110 Conjugated Antibody

C44961 100ul
EUR 397

GPR110 Polyclonal Antibody

ABP51449-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human GPR110 at AA range: 810-890
  • Applications tips:
Description: A polyclonal antibody for detection of GPR110 from Human. This GPR110 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human GPR110 at AA range: 810-890

GPR110 Polyclonal Antibody

ABP51449-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human GPR110 at AA range: 810-890
  • Applications tips:
Description: A polyclonal antibody for detection of GPR110 from Human. This GPR110 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human GPR110 at AA range: 810-890

GPR110 Polyclonal Antibody

ABP51449-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human GPR110 at AA range: 810-890
  • Applications tips:
Description: A polyclonal antibody for detection of GPR110 from Human. This GPR110 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human GPR110 at AA range: 810-890

GPR110 Polyclonal Antibody

ES2448-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GPR110 from Human. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

GPR110 Polyclonal Antibody

ES2448-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GPR110 from Human. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

GPR110 siRNA

20-abx918404
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPR110 siRNA

20-abx918405
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPR110 Blocking Peptide

DF2796-BP 1mg
EUR 195

GPR110 Blocking Peptide

DF4891-BP 1mg
EUR 195

GPR110 Blocking Peptide

20-abx064092
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Mouse GPR110 shRNA Plasmid

20-abx978802
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GPR110 shRNA Plasmid

20-abx966836
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

GPR110 ORF Vector (Human) (pORF)

ORF020338 1.0 ug DNA
EUR 405

Gpr110 ORF Vector (Mouse) (pORF)

ORF046467 1.0 ug DNA
EUR 506

G Protein-Coupled Receptor 110 (GPR110) Antibody

20-abx007923
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

G Protein-Coupled Receptor 110 (GPR110) Antibody

20-abx015251
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

G Protein-Coupled Receptor 110 (GPR110) Antibody

20-abx147426
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Gpr110 sgRNA CRISPR Lentivector set (Mouse)

K3842201 3 x 1.0 ug
EUR 339

GPR110 sgRNA CRISPR Lentivector set (Human)

K0894901 3 x 1.0 ug
EUR 339

Gpr110 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3842202 1.0 ug DNA
EUR 154

Gpr110 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3842203 1.0 ug DNA
EUR 154

Gpr110 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3842204 1.0 ug DNA
EUR 154

GPR110 sgRNA CRISPR Lentivector (Human) (Target 1)

K0894902 1.0 ug DNA
EUR 154

GPR110 sgRNA CRISPR Lentivector (Human) (Target 2)

K0894903 1.0 ug DNA
EUR 154

GPR110 sgRNA CRISPR Lentivector (Human) (Target 3)

K0894904 1.0 ug DNA
EUR 154

GPR110 Protein Vector (Mouse) (pPB-C-His)

PV185866 500 ng
EUR 1065

GPR110 Protein Vector (Mouse) (pPB-N-His)

PV185867 500 ng
EUR 1065

GPR110 Protein Vector (Mouse) (pPM-C-HA)

PV185868 500 ng
EUR 1065

GPR110 Protein Vector (Mouse) (pPM-C-His)

PV185869 500 ng
EUR 1065

GPR110 Protein Vector (Human) (pPB-C-His)

PV081349 500 ng
EUR 552

GPR110 Protein Vector (Human) (pPB-N-His)

PV081350 500 ng
EUR 552

GPR110 Protein Vector (Human) (pPM-C-HA)

PV081351 500 ng
EUR 552

GPR110 Protein Vector (Human) (pPM-C-His)

PV081352 500 ng
EUR 552

Gpr110 3'UTR Luciferase Stable Cell Line

TU108961 1.0 ml Ask for price

Gpr110 3'UTR GFP Stable Cell Line

TU158961 1.0 ml Ask for price

GPR110 3'UTR GFP Stable Cell Line

TU059201 1.0 ml
EUR 1521

GPR110 3'UTR Luciferase Stable Cell Line

TU009201 1.0 ml
EUR 1521

Mouse G- protein coupled receptor 110, Gpr110 ELISA KIT

ELI-09748m 96 Tests
EUR 865

Human Probable G- protein coupled receptor 110, GPR110 ELISA KIT

ELI-08749h 96 Tests
EUR 824

Gpr110 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3842205 3 x 1.0 ug
EUR 376

GPR110 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0894905 3 x 1.0 ug
EUR 376

Gpr110 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3842206 1.0 ug DNA
EUR 167

Gpr110 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3842207 1.0 ug DNA
EUR 167

Gpr110 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3842208 1.0 ug DNA
EUR 167

GPR110 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0894906 1.0 ug DNA
EUR 167

GPR110 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0894907 1.0 ug DNA
EUR 167

GPR110 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0894908 1.0 ug DNA
EUR 167

Anti-Anti-SEPT6 antibody antibody

STJ11100949 100 µl
EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined.

Anti-Anti-SEPT9 Antibody antibody

STJ111369 100 µl
EUR 277
Description: This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.

Anti-Anti-SEPT11 Antibody antibody

STJ111530 100 µl
EUR 277

Anti-Anti-SEPT4 Antibody antibody

STJ112276 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer.

Anti-Anti-SEPT2 Antibody antibody

STJ25475 100 µl
EUR 277

Anti-Anti-SEPT5 Antibody antibody

STJ25477 100 µl
EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-SEPT8 Antibody antibody

STJ25479 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT2 Antibody antibody

STJ28365 100 µl
EUR 277

Anti-Anti-SEPT7 Antibody antibody

STJ28963 100 µl
EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-MARCH9 Antibody antibody

STJ112609 100 µl
EUR 277

Anti-Anti-SEPT11 Antibody antibody

STJ113941 100 µl
EUR 277

Anti-Anti-SEPT11 Antibody antibody

STJ114081 100 µl
EUR 277

Anti-Anti-SEPT5 Antibody antibody

STJ114819 100 µl
EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-MARCH8 Antibody antibody

STJ114828 100 µl
EUR 277

Anti-Anti-SEPT7 Antibody antibody

STJ116214 100 µl
EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-SEPT8 Antibody antibody

STJ117206 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT12 Antibody antibody

STJ117759 100 µl
EUR 277
Description: This gene encodes a guanine-nucleotide binding protein and member of the septin family of cytoskeletal GTPases. Septins play important roles in cytokinesis, exocytosis, embryonic development, and membrane dynamics. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-MARCH6 Antibody antibody

STJ118549 100 µl
EUR 277

Anti-Anti-MARCH6 Antibody antibody

STJ118550 100 µl
EUR 277

Anti-Anti-MARCH7 Antibody antibody

STJ118752 100 µl
EUR 277

Anti-Anti-SEPT3 Antibody antibody

STJ118990 100 µl
EUR 277

Anti-Anti-SEPT1 antibody antibody

STJ119580 100 µl
EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis and the maintenance of cellular morphology. This gene encodes a protein that can form homo- and heterooligomeric filaments, and may contribute to the formation of neurofibrillary tangles in Alzheimer's disease. Alternatively spliced transcript variants have been found but the full-length nature of these variants has not been determined. [provided by RefSeq, Dec 2012]

Anti-Anti-DDB1 Antibody

A00333 100uL
EUR 455
Description: Rabbit Polyclonal DDB1 Antibody. Validated in IP and tested in Human, Mouse.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-10x96wellstestplate 10x96-wells test plate
EUR 5647.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-1x48wellstestplate 1x48-wells test plate
EUR 552.76
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-1x96wellstestplate 1x96-wells test plate
EUR 746.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-5x96wellstestplate 5x96-wells test plate
EUR 3060.6
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

4-AEA465Hu
  • EUR 5698.00
  • EUR 3011.00
  • EUR 747.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Anti-Sperm Antibody elisa. Alternative names of the recognized antigen: Anti-Spermatozoa Antibodies
  • Sperm Antibodies
  • Antisperm Antibodies
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Human Anti-AsAb (Anti-Anti-Sperm Antibody Antibody)

ELK8071 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antigen. Standards or samples are then added to the appropriate microtiter plate wells with a Horseradish Peroxidase (HRP)-conjugated secondary antibody. After TMB substrate soluti
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Anti-Anti-Sperm Antibody Antibody from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Anti-CYFIP2 Antibody

A06562 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CYFIP2 Antibody (CYFIP2) detection.tested for IHC, WB in Human, Mouse, Rat.

Anti-GPS2 Antibody

A06569 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for GPS2 Antibody (GPS2) detection. Tested with WB in Human, Mouse, Rat.

Anti-PRKX Antibody

A06585-1 100ul
EUR 397
Description: Rabbit Polyclonal PRKX Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-PPA2 Antibody

A06587 100ug/vial
EUR 294

Anti-GluR8 Antibody

A06589 100ul
EUR 397
Description: Rabbit Polyclonal GluR8 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-EDG7 Antibody

A06597-1 100ul
EUR 397
Description: Rabbit Polyclonal EDG7 Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Anti-KIR2.3 Antibody

A06605-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for KIR2.3 Antibody (KCNJ4) detection. Tested with WB in Human, Mouse, Rat.

Anti-GALK1 Antibody

A06627 100ul
EUR 397
Description: Rabbit Polyclonal GALK1 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-PRAME Antibody

A06628-2 100ug/vial
EUR 294

Anti-GP2 Antibody

A06630-1 100ug/vial
EUR 334

Anti-USP21 Antibody

A06639 100ug/200ul
EUR 397
Description: Goat Polyclonal USP21 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-TLK2 Antibody

A06645 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for TLK2 Antibody (TLK2) detection. Tested with WB in Human, Mouse.

Anti-PPP1R3C Antibody

A06658 100ul
EUR 397
Description: Rabbit Polyclonal PPP1R3C Antibody. Validated in WB and tested in Human.

Anti-LRRK1 Antibody

A06670 100ul
EUR 397
Description: Rabbit Polyclonal LRRK1 Antibody. Validated in IF, IHC and tested in Human.

Anti-MNDA Antibody

A06675 100ul
EUR 397
Description: Rabbit Polyclonal MNDA Antibody. Validated in WB and tested in Human.

Anti-KAL1 Antibody

A06684 100ul
EUR 397
Description: Rabbit Polyclonal KAL1 Antibody. Validated in WB and tested in Human.

Anti-COL14A1 Antibody

A06685 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for COL14A1 Antibody (COL14A1) detection.tested for IHC in Human, Mouse, Rat.

Anti-CYP4B1 Antibody

A06690 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CYP4B1 Antibody (CYP4B1) detection.tested for WB in Human.

Anti-RFX2 Antibody

A06709 100ul
EUR 397
Description: Rabbit Polyclonal RFX2 Antibody. Validated in IHC and tested in Human.

Anti-GPR92 Antibody

A06721 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for GPR92 Antibody (LPAR5) detection. Tested for WB, IHC, IF in Human.

Anti-MBTPS1 Antibody

A06735 100ul
EUR 397
Description: Rabbit Polyclonal MBTPS1 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-PLA2G1B Antibody

A06738 100ug/200ul
EUR 397
Description: Goat Polyclonal PLA2G1B Antibody. Validated in WB and tested in Human.

Anti-GNB5 Antibody

A06754 100ul
EUR 397
Description: Rabbit Polyclonal GNB5 Antibody. Validated in IHC, WB and tested in Human.

Anti-BAIAP2L1 Antibody

A06770 100ul
EUR 397
Description: Rabbit Polyclonal BAIAP2L1 Antibody. Validated in WB and tested in Human.

Anti-IRTKS Antibody

A06770-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for IRTKS Antibody (BAIAP2L1) detection.tested for WB in Human, Mouse, Rat.

Anti-MLF1 Antibody

A06772 100ul
EUR 397
Description: Rabbit Polyclonal MLF1 Antibody. Validated in WB and tested in Human, Mouse.

Anti-NDR2 Antibody

A06774 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for NDR2 Antibody (STK38L) detection.tested for WB in Human, Mouse, Rat.

Anti-LARG Antibody

A06802-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for LARG Antibody (ARHGEF12) detection. Tested with WB in Human, Mouse, Rat.

Anti-GAS1 Antibody

A06815-1 100ul
EUR 397
Description: Rabbit Polyclonal GAS1 Antibody. Validated in WB and tested in Human, Mouse.

Anti-APLF Antibody

A06828-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for APLF Antibody (APLF) detection.tested for WB in Human, Mouse.

Anti-PKCB1 Antibody

A06830 100ul
EUR 397
Description: Rabbit Polyclonal PKCB1 Antibody. Validated in WB and tested in Human.

Anti-DnaJB4 Antibody

A06835-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for DnaJB4 Antibody (DNAJB4) detection.tested for WB in Human, Mouse, Rat.

Anti-ArfGAP3 Antibody

A06839 100uL
EUR 455
Description: Rabbit Polyclonal ArfGAP3 Antibody. Validated in IP, IF, WB and tested in Human.

Anti-SCN2B Antibody

A06842 100ul
EUR 397
Description: Rabbit Polyclonal SCN2B Antibody. Validated in WB and tested in Human.

Anti-CD316 Antibody

A06844 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CD316 Antibody (IGSF8) detection. Tested with WB in Human, Mouse.

Anti-AMOTL2 Antibody

A06852 100ug/vial
EUR 294

Anti-POM121 Antibody

A06856 100ul
EUR 397
Description: Rabbit Polyclonal POM121 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-TBX22 Antibody

A06861 100ul
EUR 397
Description: Rabbit Polyclonal TBX22 Antibody. Validated in WB and tested in Human.

Anti-QORX Antibody

A06870 100ul
EUR 397
Description: Rabbit Polyclonal QORX Antibody. Validated in WB and tested in Human.

Anti-ADAM28 Antibody

A06873-1 100ug/vial
EUR 294

Anti-Adam28 Antibody

A06873-2 100ug/vial
EUR 334

Anti-KSR2 Antibody

A06876 100ul
EUR 397
Description: Rabbit Polyclonal KSR2 Antibody. Validated in IF, WB and tested in Human, Mouse.

Anti-Recoverin Antibody

A06882 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Recoverin Antibody (RCVRN) detection.tested for WB in Human, Mouse.

Anti-CRP1 Antibody

A06894 100ul
EUR 397
Description: Rabbit Polyclonal CRP1 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-CD297 Antibody

A06913 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CD297 Antibody (ART4) detection.tested for IHC in Human.

Anti-TAF12 Antibody

A06944-1 100ug/vial
EUR 334

Anti-AKR7A2 Antibody

A06949-1 100ug/vial
EUR 334

Anti-IPMK Antibody

A06955 100ul
EUR 397
Description: Rabbit Polyclonal IPMK Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-ARHGEF10 Antibody

A06958 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for ARHGEF10 Antibody (ARHGEF10) detection.tested for WB in Human, Monkey.

Anti-BMP10 Antibody

A06968 100ul
EUR 397
Description: Rabbit Polyclonal BMP10 Antibody. Validated in WB and tested in Human.

Anti-SGK269 Antibody

A06989 100ul
EUR 397
Description: Rabbit Polyclonal SGK269 Antibody. Validated in WB and tested in Human, Mouse.

Anti-MAST205 Antibody

A07003 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for MAST205 Antibody (MAST2) detection.tested for WB in Human, Mouse.

Anti-TFF2 Antibody

A07013-1 100ug/vial
EUR 334

Anti-TFF2 Antibody

A07013-2 100ug/vial
EUR 334

Anti-FOXK1 Antibody

A07015 100ul
EUR 397
Description: Rabbit Polyclonal FOXK1 Antibody. Validated in WB and tested in Human, Mouse.

Anti-CD158z Antibody

A07017 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CD158z Antibody (KIR3DL3) detection.tested for IHC, WB in Human.

Anti-TSEN54 Antibody

A07022 100ul
EUR 397
Description: Rabbit Polyclonal TSEN54 Antibody. Validated in IHC, WB and tested in Human, Mouse.

Anti-SAR1B Antibody

A07030 100ul
EUR 397
Description: Rabbit Polyclonal SAR1B Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-Peropsin Antibody

A07038 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Peropsin Antibody (RRH) detection. Tested with WB in Human.

Anti-RALY Antibody

A07043 100ul
EUR 397
Description: Rabbit Polyclonal RALY Antibody. Validated in WB and tested in Human.

Anti-Raly Antibody

A07043-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Raly Antibody (RALY) detection. Tested with WB in Human, Mouse, Rat.

Anti-Osteoglycin Antibody

A07061 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Osteoglycin Antibody (OGN) detection. Tested with WB in Human, Mouse.

Anti-APC10 Antibody

A07065-1 100ug
EUR 455
Description: Rabbit Polyclonal APC10 Antibody. Validated in IP, WB and tested in Human.

Anti-RRBP1 Antibody

A07074-1 100ug/vial
EUR 334

Anti-DGKH Antibody

A07077-1 100ul
EUR 397
Description: Rabbit Polyclonal DGKH Antibody. Validated in IF, IHC and tested in Human, Mouse.

Anti-NUP93 Antibody

A07090 100ul
EUR 397
Description: Rabbit Polyclonal NUP93 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-RBM20 Antibody

A07094 100ug/200ul
EUR 397
Description: Goat Polyclonal RBM20 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-RhoH Antibody

A07101 100ul
EUR 397
Description: Rabbit Polyclonal RhoH Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Anti-ZNF265 Antibody

A07103 100ul
EUR 397
Description: Rabbit Polyclonal ZNF265 Antibody. Validated in IF, WB and tested in Human.

Anti-ZIS Antibody

A07103-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for ZIS Antibody (ZRANB2) detection.tested for WB in Human, Mouse, Rat.

Anti-BCAS3 Antibody

A07120 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for BCAS3 Antibody (BCAS3) detection. Tested with WB in Human, Mouse.

Anti-TAF3 Antibody

A07129 100ul
EUR 397
Description: Rabbit Polyclonal TAF3 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-TIMP4 Antibody

A07131 100ug/vial
EUR 334

Anti-NIPA Antibody

A07135 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for NIPA Antibody (ZC3HC1) detection.tested for WB in Human, Mouse, Rat, Monkey.

Anti-ATP1AL1 Antibody

A07149 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for ATP1AL1 Antibody (ATP12A) detection. Tested with WB in Human, Rat.

Anti-HoxB5 Antibody

A07156 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for HoxB5 Antibody (HOXB5) detection. Tested with WB in Human, Mouse.

Anti-ARRDC3 Antibody

A07177 100ul
EUR 397
Description: Rabbit Polyclonal ARRDC3 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-RGS5 Antibody

A07178 100ul
EUR 397
Description: Rabbit Polyclonal RGS5 Antibody. Validated in IHC, WB and tested in Human, Mouse.

Anti-MLF1 Antibody

A07180 100uL
EUR 443
Description: Rabbit Polyclonal MLF1 Antibody. Validated in IHC, WB and tested in Human.

Anti-G2A Antibody

A07182 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for G2A Antibody (GPR132) detection.tested for WB in Human, Mouse, Monkey.

Anti-NICE4 Antibody

A07183 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for NICE4 Antibody (UBAP2L) detection. Tested with WB in Human, Mouse.

Anti-USP36 Antibody

A07184 100ul
EUR 397
Description: Rabbit Polyclonal USP36 Antibody. Validated in IHC and tested in Human.

Anti-GPR1 Antibody

A07199 100ul
EUR 397
Description: Rabbit Polyclonal GPR1 Antibody. Validated in IF and tested in Human, Mouse, Rat.

Anti-Tis7 Antibody

A07201 100 ug
EUR 397
Description: Rabbit Polyclonal Tis7 Antibody. Validated in WB and tested in Human.

Anti-APEX2 Antibody

A07203 100ug/vial
EUR 294

Anti-TRIM59 Antibody

A07207 100ul
EUR 397
Description: Rabbit Polyclonal TRIM59 Antibody. Validated in IF, IHC, WB and tested in Human, Mouse.

Anti-GCN5 Antibody

A07210 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for GCN5 Antibody (KAT2A) detection.tested for WB in Human, Mouse.

Anti-CNT2 Antibody

A07211-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CNT2 Antibody (SLC28A2) detection.tested for WB in Human, Mouse, Rat.

Anti-D54 Antibody

A07219-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for D54 Antibody (TPD52L2) detection. Tested with WB in Human, Mouse, Rat.

Anti-ST7 Antibody

A07235 100ug/vial
EUR 294

Anti-RAB3GAP2 Antibody

A07244 100ul
EUR 397
Description: Rabbit Polyclonal RAB3GAP2 Antibody. Validated in IHC, WB and tested in Human, Mouse.

Anti-RAB3GAP2 Antibody

A07244-3 100ug/vial
EUR 334

Leave a Reply

Your email address will not be published. Required fields are marked *